Gene record

GRMZM2G083841/ZEAMMB73_347510 (pep1 - phosphoenolpyruvate carboxylase1) [Classical Gene List]

   GENE MODEL        SEQUENCE       GENETIC INFORMATION        
Note: A gene is a specific type of locus; the word "gene" should not be considered to be synonymous with "locus".


Overview

Gene name: pep1 (phosphoenolpyruvate carboxylase1) Plant Wide Gene Name: Ppc1  
Synonyms: csu905, csu975, csuh00905, csuh00975, IDP2529, npi332(pep), PEPC1, phi065 (per Senior, L)

Gene Products:


Description:

cytosolic C4 isozyme; single copy, similar to C3-PEPCase genes; cDNA complements E. coli mutant; genomic and partial amino acid sequences compare; SSR phi065



ENTREZ Gene: 542372
Type: Gene
Species: Zea mays ssp. mays

Linkage Group: 9
Bin: 9.03


Properties: MNL Gene List


Expression Induction: Expression of this locus is induced by light


Associated Gene Models:

ZEAMMB73_666930 [Classical Gene] (Gramene ID: GRMZM2G083841) (Genome Browser)


BACs:
   c0168C06 (via in silico)

Probes:
   p-umc180 (via RFLP Hybridization)
   p-pepcZm1(exon 8) (via RFLP Hybridization)
   p-pepcZm1(f) (via RFLP Hybridization)
   p-pepcZm1 (via RFLP Hybridization)
   p-PEPC1-Lc2.4 (via RFLP Hybridization)
   p-pM52 (via RFLP Hybridization)
   IDP2529 (via INDEL)

SSRs:
   p-phi065 (via SSR PCR)

Related Loci:

cent9 centromere chromosome 9 Near
dof1 DNA-binding with one finger1 Regulated By
ppc Complements
umc180(pep) possibly identical


Offsite Resources:
  Classical Genes -> GRMZM2G083841
  Ecoli DB @ CGSC -> Site/368
  GenBank -> AY103747
  GenBank -> x07171
   

Annotations

Annotate this record

 Add ontology terms
 Add free text annotation


No ontology terms attached to this record


Comments:
Brief Description: cytosolic C4 isozyme; single copy, similar to C3-PEPCase genes; cDNA complements E. coli mutant; genomic and partial amino acid sequences compare; SSR phi065

Annotation: Map data for chromosome 9, taken with single copy information, are in conflict with umc180(pep1) map data, placed in chromosome 6 in an early map (UMC 93 6) but not placed since. Unresolved in the absence of a sequence. Possibly duplicate loci.

Map Note: Genetic 2008 location from asg63a -1- pep1 -0.1- elfa4 (cIBM2006 9)

Map Note: Genetic 9 coordinate revised from 57.00 to 56.8 based on recombination data and BAC match in B73 v2 (EHC May 2015)

Annotation: C4-PEP carboxylase (Kawamura et al. 1992)

Expression: mRNA levels highest in mesophyll cells of leaves; low levels in husks; very low levels in bundle sheath; not in root, etiolated leaf, stems; pep1 promoter used with lc1 (p-PEPC1-Lc2.4) as potential tool for cell fate analysis (Lusardi et al 1994)

Map Note: [resolved May 2015 by placement of ctg106 in chr9, B73 v2] Map location unclear: although numerous experiments with probes attributed to pep1 locate it in chr9, sequences match closely to BAC c0168C06 in ctg106, an unanchored contig that may or may not be in chr2. An overgo, PCO070206, finds the same BAC but no others in ctg106, and BACs in several other contigs, none of which fall in chr9 (EH Coe Feb 2008)

No user annotations


   

Chromosome Coordinates



   B73 RefGen_v2 sequence   
Locus Lookup results based on:

Gene models:
The Locus pep1 is between 61,296,279 and 61,301,686 on Chromosome 9 based on gene model GRMZM2G083841.
See details

Physically mapped:
The Locus pep1 has not been physically mapped.
See details

Placed BACs:
The Locus pep1 is not associated with physically mapped probes.
See details

Genetically mapped:
The Locus pep1 is between 26,961,864 and 28,438,487 on Chromosome 9 based on the following nearest loci on the IBM2 2008 Neighbors map that are physically placed: (IDP3828 and TIDP5397).
See details

   

Map Coordinates

(* indicates the locus is on the backbone)
Map Coordinate Bin
B73/H99 RI 1999 9 60.00 9.03
B73/Mo17 RI 1996 9 64.70 9.03
B73/Mo17 RI 1997 9 63.70 9.03
B73/Mo17 RI 1999 9 65.10 9.03
bins 9 9.03    9.03
cIBM2006 9 259.20
Genetic 9 * 56.80
IBM2 2005 Neighbors 9 226.76
IBM2 2005 Neighbors Frame 9 226.76
IBM2 2008 Neighbors 9 227.20
IBM2 2008 Neighbors Frame 9 227.20
IBM GNP2004 9 * 46.00
ISU IBM Map4 9 59.80
ISU IBM Map7 9 65.20
ISU Integrated IBM 2009 9 76.40
LHRF Gnp2004 9 * 56.00
Mo17/H99 F6:7 1996 9 45.00 9.03
Mo17/H99 RI 1996 9 45.00 9.03
Mo17/H99 RI QTL 1998 9 45.00 9.03
NPI 1990 9 50.00 9.03
oat-maize RH 9 12.00 9.03
Pioneer composite 1999 9 61.60 9.03
SSR Consensus 9 45.60 9.03
   

Nearby Loci


These are nearby loci on a selection of high-res maps.
Change Map:

IBM2 2008 Neighbors Frame 9

218.4 TIDP6176
219.4 pzb00959
219.4 umc2338
219.7 pco095808
220.1 umc2337
220.3 gpm830b
220.7 psr160c
221.7 umc2370
221.7 pza03469
221.7 pco107884
222.9 IDP9071
222.9 IDP8457
223.9 rz273c(ant)
224.0 pzb00014
224.1 phs1
224.1 dzs10
224.1 fdh2
224.3 ago101
224.3 gpm46
224.3 gpm721
225.9 pza00925
225.9 pza03057
226.0 lgn1
226.3 rz953
226.3 umc81
226.3 IDP4017
226.3 bnlg127
226.4 oec2
226.7 pza01791
226.8 cent9
226.8 mrpa1
227.2 pep1
227.3 ucsd1.8a
227.4 bcd1421
227.5 pzb00761
228.1 vpp2
228.1 gpm820a
228.3 php20052
228.6 pza01861
229.1 bnl5.10
230.1 fat1
230.1 hsbp2
230.1 pza02545
230.6 csu623a
232.4 elfa9
232.5 haf101b
232.8 umc1191
235.1 pco102100
235.2 bnlg1626
235.5 mmp2
235.6 TIDP6547
235.6 IDP7170
235.6 IDP7401
235.6 TIDP5246
235.6 IDP7003
235.6 IDP7012
235.6 TIDP2726
235.6 TIDP3530
235.6 IDP4151
235.6 TIDP6148
235.6 TIDP5827
235.6 TIDP5397
235.6 TIDP6705
237.1 php20075b(ext)
237.2 umc1420
Change Map:

NAM

This locus is not mapped on NAM.

Change Map:

IBM2 2008 Neighbors 9

218.4 TIDP6176
219.4 pzb00959
219.4 umc2338
219.7 pco095808
220.1 umc2337
220.3 gpm830b
220.7 psr160c
221.7 pza03469
221.7 pco107884
221.7 umc2370
222.9 IDP9071
222.9 IDP8457
222.9 IDP6612
223.9 rz273c(ant)
224.0 pzb00014
224.1 fdh2
224.1 phs1
224.1 dzs10
224.1 gpm133
224.1 gpm902
224.1 gpm33c
224.1 gpm339b
224.1 nact12
224.3 gpm137a
224.3 ago101
224.3 gpm721
224.3 gpm46
225.5 npi416
225.5 bnl5.33c
225.5 bnl7.24a
225.5 uaz161b(elf)
225.9 pza03057
225.9 pza00925
226.0 lgn1
226.3 umc81
226.3 IDP4017
226.3 rz953
226.3 bnlg127
226.4 oec2
226.5 IDP3828
226.5 IDP8295
226.6 gpm566a
226.7 pza01791
226.8 mrpa1
226.8 cent9
227.0 gpm171a
227.2 pep1
227.3 ucsd1.8a
227.4 bcd1421
227.5 pzb00761
227.6 agrr125
228.0 pebp26
228.0 TB-9Lc(9)
228.1 vpp2
228.1 gpm682
228.1 gpm820a
228.3 php20052
228.4 ras11D1
228.6 pza01861
229.1 umc2573
229.1 bnl5.10
229.1 mHbrBG132-Mo17
229.2 mHbrBA189-Mo17
230.0 bnl5.46b
230.1 hsbp2
230.1 fat1
230.1 umc1599
230.1 pza02545
230.6 csu623a
230.8 gpm183c
232.0 pg12
232.0 ar1
232.0 fae2
232.4 elfa9
232.5 haf101b
232.8 umc1191
233.4 gpm240b
233.8 cdo673
233.8 cdo319
233.8 bcd221b
234.7 agrr64
235.1 pco102100
235.2 bnlg1626
235.5 mmp2
235.6 TIDP5246
235.6 IDP7003
235.6 IDP7012
235.6 TIDP2726
235.6 TIDP3530
235.6 IDP4151
235.6 IDP7401
235.6 TIDP5827
235.6 TIDP5397
235.6 TIDP6705
235.6 TIDP6148
235.6 TIDP6547
235.6 IDP7170
236.0 obf2
237.1 php20075b(ext)
237.1 pbs14d
237.1 pbs14b
237.2 umc1420
Change Map:

Genetic 9

47.0 eps1
47.0 TB-9Sb(9)
47.0 tk1
47.5 lim286
47.9 wx1
48.0 T6-9b(9)
48.0 T9-10(059-10)(9)
48.0 T9-10(8630)(9)
48.0 lag1
48.0 dhn2
48.0 T5-9(4871)(9)
48.0 T8-9(043-6)(9)
48.0 T8-9(5300)(9)
48.3 umc1634
48.9 umc1258
49.1 AY109570
49.9 umc1586
50.6 lim101
51.0 T5-9a(9)
51.0 T5-9(8386)(9)
51.0 krp2
51.0 hsk1
51.1 fdad1
51.1 ufg71
52.0 d3
52.1 mmp170b
53.0 T1-9(4398)(9)
53.0 T2-9(6656)(9)
53.0 T8-9(6673)(9)
53.0 T3-9(5775)(9)
53.0 T4-9(5657)(9)
53.0 T8-9(5391)(9)
54.0 T5-9(4817)(9)
54.0 w11
54.0 T1-9(4995)(9)
54.0 T7-9a(9)
54.1 psr160d
54.9 umc2338
55.0 T9-10b(9)
55.0 umc2337
55.2 psr160c
56.0 rz273c(ant)
56.0 TB-9Sd(9)
56.0 T6-9(4505)(9)
56.0 T7-9(6225)(9)
56.0 T7-9(8383)(9)
56.0 T3-9(020-5)(9)
56.5 lgn1
56.5 fdh2
56.5 dzs10
56.5 phs1
56.6 umc81
56.6 rz953
56.6 oec2
56.7 cent9
56.7 mrpa1
56.8 pep1
56.9 bcd1421
57.0 TB-9Lc(9)
57.0 pebp26
57.0 vpp2
57.1 php20052
57.1 ras11D1
57.3 bnl5.10
57.5 bnl5.46b
57.5 ago101
57.5 fat1
57.5 hsbp2
57.5 umc1599
57.7 csu623a
57.8 rf2
57.8 conz1
58.0 pg12
58.0 v1
58.0 T2-9(5257)(9)
58.0 fae2
58.0 ar1
58.0 ms2
58.0 T3-9c(9)
58.1 elfa9
58.2 umc1191
58.9 mmp2
59.0 T8-9(4643)(9)
59.0 T1-9(024-7)(9)
59.0 T3-9(8562)(9)
59.0 T8-9(6921)(9)
59.0 T5-9c(9)
59.0 T5-9(5614)(9)
59.0 T2-9(5711)(9)
59.0 obf2
59.5 asg63a
59.6 umc2340
59.7 umc2339
60.0 T9-10(4303-9)(9)
60.0 T2-9b(9)
60.0 T1-9(8918)(9)
60.1 umc1271
60.4 knox2
60.5 mch1
60.5 endo1
60.8 acp1
61.0 T3-9(8447)(9)
61.0 T4-9(004-7)(9)
61.0 sal1
61.0 T4-9f(9)
61.0 T5-9(022-11)(9)
61.0 T4-9g(9)
61.0 T4-9e(9)
61.0 T1-9(8129)(9)
61.0 gl15
62.0 T1-9(8389)(9)
62.3 umc20
62.4 umc1921
63.0 T5-9(008-18)(9)
63.0 T4-9(4373)(9)
63.0 T6-9(5831)(9)
63.0 T1-9(8460)(9)
63.0 T6-9(6270)(9)
63.0 T3-9g(9)
63.0 T6-9e(9)
63.0 T7-9(071-1)(9)
63.1 umc2087
63.4 AW257883
63.5 umc1743
63.6 umc114
63.6 csu147
63.6 znf1
63.7 AY103770
64.0 mlo7
64.0 T1-9a(9)
64.0 T1-9(8302)(9)
64.0 T4-9c(9)
64.0 T4-9b(9)
64.0 trn1
64.0 T7-9c(9)
64.0 bnl5.04
64.3 hm2
64.4 umc1267
64.4 rpo2
64.6 rz682
65.0 lim99b
65.0 asn1
65.0 T1-9c(9)
66.0 T6-9(6019)(9)
66.0 T3-9e(9)
66.2 bnl7.13a
66.5 sbp4 (Cardon)
66.6 bnlg1714
66.7 hscf1
   

Allele/variation/polymorphism

IDP2529-B73 (DNA polymorphism) IDP2529-Mo17 (DNA polymorphism) Pep1-38-11 (Allele)
Pep1-A (Allele) Pep1-A12 (Allele) Pep1-A188 (Allele)
Pep1-A554 (Allele) Pep1-A619 (Allele) Pep1-A632 (Allele)
Pep1-A634 (Allele) Pep1-A635 (Allele) Pep1-A641 (Allele)
Pep1-B14A (Allele) Pep1-B164 (Allele) Pep1-B2 (Missouri) (Allele)
Pep1-B37 (Allele) Pep1-B52 (Allele) Pep1-B68 (Allele)
Pep1-B73 (Allele) [Links] Pep1-B76 (Allele) Pep1-B77 (Allele)
Pep1-B84 (Allele) Pep1-B95 (Allele) Pep1-B97 (Allele)
Pep1-C103 (Allele) Pep1-C11 (Allele) Pep1-C123 (Allele)
Pep1-C49A (Allele) Pep1-CI187-2 (Allele) Pep1-CM105 (Canada) (Allele)
Pep1-CM37 (Allele) Pep1-CMV3 (Allele) Pep1-CO159 (DNA polymorphism)
Pep1-D940Y (Allele) Pep1-DE811 (Allele) Pep1-dent (Allele) [Links]
Pep1-E2558W (Allele) Pep1-EP1 (Allele) Pep1-F2 (Allele)
Pep1-F2834T (Allele) Pep1-F44 (Allele) Pep1-Golden Cross Bantam (Allele) [Links]
Pep1-GT112 (Allele) Pep1-GT119 (DNA polymorphism) Pep1-H84 (Allele) [Links]
Pep1-H95 (Allele) Pep1-H99 (Allele) Pep1-HP301 (Allele)
Pep1-Hy (Allele) Pep1-hybrid FR9 cms FR37 (Allele) [Links] Pep1-I137TN (Allele)
Pep1-I205 (Allele) Pep1-I29 (Allele) Pep1-IA2132 (Allele)
Pep1-IDS28 (Allele) Pep1-IDS91 (Allele) Pep1-IL677A (Allele)
Pep1-K55 (Allele) Pep1-K64 (Allele) Pep1-Ki14 (Allele)
Pep1-KI1986 (Allele) [Links] Pep1-KIpM500 (Allele) [Links] Pep1-Ky21 (Allele)
Pep1-Ky226 (Allele) Pep1-Ky228 (Allele) Pep1-L317 (Allele)
Pep1-M14 (Allele) Pep1-M37W (Allele) Pep1-Mo17 (Allele)
Pep1-Mt42 (Allele) Pep1-N28(Ht) (Allele) Pep1-NC258 (Allele)
Pep1-NC268 (Allele) Pep1-NC296 (Allele) Pep1-NC298 (Allele)
Pep1-NC300 (Allele) Pep1-NC304 (Allele) Pep1-Oh07B (Allele)
Pep1-Oh40B (Allele) Pep1-Oh43 (Allele) Pep1-Os420 (Allele)
Pep1-P39 (Allele) Pep1-Pa91 (Allele) Pep1-R177 (Allele)
Pep1-R4 (Allele) Pep1-SA24 (Allele) Pep1-SC213 (Allele)
Pep1-SC76 (Allele) Pep1-SG1533 (Allele) Pep1-T218 (DNA polymorphism)
Pep1-T232 (Allele) Pep1-T8 (Allele) Pep1-Tx303 (Allele)
Pep1-Tx601 (Allele) Pep1-U267Y (Allele) Pep1-Va102 (Allele)
Pep1-Va22 (Allele) Pep1-Va35 (Allele) Pep1-Va59 (Allele)
Pep1-Va99 (Allele) Pep1-W117Ht (Allele) Pep1-W153R (Allele)
Pep1-W182B (Allele) Pep1-W64A (Allele) Pep1-Wf9 (Allele)
Pep1-Z561 (Allele) [Links] Pep1-zm1 (Allele) [Links]  

   

Genetic information


Primers and Enzymes:
Primer/Enzyme Probe
actgctcgtgtcgtgtgc IDP2529
GGGTATATAACGTGAGTAGCATATCG IDP2529
AGGGACAAATACGTGGAGACACAG p-phi065
CGATCTGCACAAAGTGGAGTAGTC p-phi065

Gel Patterns:
IDP2529 B73 IDP2529 Mo17 phi065 SSR/38-11 phi065 SSR/A phi065 SSR/A12
phi065 SSR/A188 phi065 SSR/A554 phi065 SSR/A619 phi065 SSR/A632 phi065 SSR/A634
phi065 SSR/A635 phi065 SSR/A641 phi065 SSR/B14A phi065 SSR/B164 phi065 SSR/B2
phi065 SSR/B37 phi065 SSR/B52 phi065 SSR/B68 phi065 SSR/B73 phi065 SSR/B76
phi065 SSR/B77 phi065 SSR/B84 phi065 SSR/B95 phi065 SSR/B97 phi065 SSR/C103
phi065 SSR/C11 phi065 SSR/C123 phi065 SSR/C49A phi065 SSR/CI187-2 phi065 SSR/CM105
phi065 SSR/CM37 phi065 SSR/CML015 phi065 SSR/CML049 phi065 SSR/CML078 phi065 SSR/CML142
phi065 SSR/CML176 phi065 SSR/CML202 phi065 SSR/CML206 phi065 SSR/CML216 phi065 SSR/CML246
phi065 SSR/CML247 phi065 SSR/CML249 phi065 SSR/CML254 phi065 SSR/CML258 phi065 SSR/CML264
phi065 SSR/CML268 phi065 SSR/CML273 phi065 SSR/CML274 phi065 SSR/CML279 phi065 SSR/CML282
phi065 SSR/CML287 phi065 SSR/CML291 phi065 SSR/CML299 phi065 SSR/CML310 phi065 SSR/CML311
phi065 SSR/CML316 phi065 SSR/CML321 phi065 SSR/CML323 phi065 SSR/CML324 phi065 SSR/CML327
phi065 SSR/CML329 phi065 SSR/CML334 phi065 SSR/CML339 phi065 SSR/CML341 phi065 SSR/CML343
phi065 SSR/CML344 phi065 SSR/CML348 phi065 SSR/CML349 phi065 SSR/CML354 phi065 SSR/CML363
phi065 SSR/CML366 phi065 SSR/CML373 phi065 SSR/CML384 phi065 SSR/CMV3 phi065 SSR/CO159
phi065 SSR/D940Y phi065 SSR/DE811 phi065 SSR/E2558W phi065 SSR/EP1 phi065 SSR/F2
phi065 SSR/F2834T phi065 SSR/F44 phi065 SSR/GT112 phi065 SSR/GT119 phi065 SSR/H95
phi065 SSR/H99 phi065 SSR/HP301 phi065 SSR/HY phi065 SSR/I137TN phi065 SSR/I205
phi065 SSR/I29 phi065 SSR/IA2132 phi065 SSR/IDS28 phi065 SSR/IDS91 phi065 SSR/IL677A
phi065 SSR/K55 phi065 SSR/K64 phi065 SSR/KI14 phi065 SSR/KY21 phi065 SSR/KY226
phi065 SSR/KY228 phi065 SSR/L317 phi065 SSR/M14 phi065 SSR/M37W phi065 SSR/MO17
phi065 SSR/MT42 phi065 SSR/N28(HT) phi065 SSR/NC258 phi065 SSR/NC268 phi065 SSR/NC296
phi065 SSR/NC298 phi065 SSR/NC300 phi065 SSR/NC304 phi065 SSR/OH07B phi065 SSR/OH40B
phi065 SSR/OH43 phi065 SSR/OS420 phi065 SSR/P39 phi065 SSR/PA91 phi065 SSR/Pool24
phi065 SSR/Pop21 phi065 SSR/Pop22 phi065 SSR/Pop25 phi065 SSR/Pop29 phi065 SSR/Pop32
phi065 SSR/Pop43 phi065 SSR/R177 phi065 SSR/R4 phi065 SSR/SA24 phi065 SSR/SC213
phi065 SSR/SC76 phi065 SSR/SG1533 phi065 SSR/T218 phi065 SSR/T232 phi065 SSR/T8
phi065 SSR/TX303 phi065 SSR/TX601 phi065 SSR/U267Y phi065 SSR/VA102 phi065 SSR/VA22
phi065 SSR/VA35 phi065 SSR/VA59 phi065 SSR/VA99 phi065 SSR/W117HT phi065 SSR/W153R
phi065 SSR/W182B phi065 SSR/W64A phi065 SSR/WF9


Map Scores:
chr 9: pep1 B73 x Mo17 RI SSR
IDP2529 intermated B73 X Mo17 RI-94 InDel
pep1 B73 x Mo17 RI SSR
phi065 Mo17 x H99 F6:7 RI SSR

Recombination Data:
(d*-N1803B pep1) 2002
npi266 bnl3.06 TB-9Lc umc20 bnl7.13 '89
npi266 bnl3.06 TB-9Sd (pep1, bnl5.10)
sh1 npi266 TB-9Sb (npi300a, bnl3.06)
(w11 pep1) 2002
   

References


Related Papers:

(Classical Gene List) Schnable, J; Freeling, M. 2011. PLoS One 6(3):e17855. doi:10.1371/journal.pone.0017855

(map note) Kowles, RV et al. 2008. Maydica 53:69-78

(diversity) Besnard, G et al. 2002. Theor Appl Genet 105:404-412

(promoter analysis) Kausch, AP et al. 2001. Mesophyll-specific, light and metabolic regulation of the C(4)PPCZm1 promoter in transgenic maize. Plant Mol Biol 45:1-15

(regulation) Kausch, AP et al. 2001. Mesophyll-specific, light and metabolic regulation of the C(4)PPCZm1 promoter in transgenic maize. Plant Mol Biol 45:1-15

(Review) Matsuoka, M et al. 2001. Molecular engineering of C-4 photosynthesis. Annu Rev Plant Physiol Plant Mol Biol 52:297-314

(transgenic expression) Kausch, AP et al. 2001. Mesophyll-specific, light and metabolic regulation of the C(4)PPCZm1 promoter in transgenic maize. Plant Mol Biol 45:1-15

(regulation) Yanagisawa, S and Sheen, J. 1998. Plant Cell 10:75-89

(expression in E.coli) Dong, L et al. 1997. Biosci Biotechnol Biochem 61:545-546

(gene product) Duff, SG et al. 1996. Planta 199:467-474

(map location) Senior, ML et al. 1996. MNL 70:50-54

(Probe) Chin, E et al. 1996. Genome 39:866-873

(gene product) Yano, M; Terada, K; Umiji, K; Izui, K. 1995. J Biochem 117:1196-1200

(gene product) Osaki, M; Iyoda, M; Tadano, T. 1995. Soil Sci Plant Nutr 41:275-283

(gene product) Osaki, M; Iyoda, M; Tadano, T. 1995. Soil Sci Plant Nutr 41:295-303

(transgenic expression) Dong, L et al. 1995. Acta Phytophysiol Sin 21:281-288

(cell fate) Lusardi, MC; Neuhaus-Url, G; Potrykus, I; Neuhaus, G. 1994. Plant J 5:571-582

(gene expression) Suzuki, I; Cretin, C; Omata, T; Sugiyama, T. 1994. Plant Physiol 105:1223-1229

(gene product) Ghosh, S; Glick, BR; Heikkila, JJ; Dumbroff, EB. 1994. Plant Physiol Biochem 32:45-54

(gene product) Wu, MX; Wedding, RT. 1994. Plant Cell Physiol 35:569-574

(gene product) Rajagopalan, AV; Devi, MT; Raghavendra, AS. 1994. Photosynth Res 39:115-135

(regulation) Sheen, J. 1994. Photosynth Res 39:427-438

(codon usage) Fennoy, SL and Bailey-Serres, J. 1993. Nucl Acid Res 21:5294-5300

(gene product) Amancio, S; Diogo, E; Santos, H. 1993. Physiol Plant 89:618-625

(map note) Gardiner, J et al. 1993. Genetics 134:917-930

(gene product) Sugiharto, B and Sugiyama, T pp.39-42 in Murata, N. 1992.Kluwer Academic, Dordrecht, Netherlands

(gene product) Sugiharto, B et al. 1992. Plant Physiol 100:2066-2070

(promoter analysis) Kano-Murakami, Y and Matsuoka, M pp.843-846 in Murata, N. 1992. p. IXth International Congress on Photosynthesis, Nagoya, Japan

(promoter analysis) Schaffner, AR and Sheen, J. 1992. Plant J 2:221-232

(general) Kawamura, T et al. 1992. J Biochem 112:147-154

(gene product) Jiao, J and Chollet, R. 1991. Plant Physiol 95:981-985

(gene product) Jiao, J and Chollet, R. 1990. Arch Biochem Biophys 283:300-305

(transgenic expression) Yanagisawa, S and Izui, K. 1990. Agric Biol Chem 54:241-243

(general) Kawamura, T et al. 1990. J Biochem 107:165-168

(general) Sheen, J. 1990. Plant Cell 2:1027-1038

(cDNA sequence) Hudspeth, RL. 1989. Plant Mol Biol 12:579-589

(gene expression) Hudspeth, RL. 1989. Plant Mol Biol 12:579-589

(genomic sequence) Matsuoka, M and Minami, E-I. 1989. Eur J Biochem 181:593-598

(genomic sequence) Hudspeth, RL. 1989. Plant Mol Biol 12:579-589

(map data) Weber, DF and Helentjaris, T. 1989. Genetics 121:583-590

(polypeptide sequence) Hudspeth, RL. 1989. Plant Mol Biol 12:579-589

(restriction map) Matsuoka, M and Minami, E-I. 1989. Eur J Biochem 181:593-598

(transcription start) Hudspeth, RL. 1989. Plant Mol Biol 12:579-589

(transcription start) Matsuoka, M and Minami, E-I. 1989. Eur J Biochem 181:593-598

(Variation) Yanagisawa, S and Izui, K. 1989. J Biochem 106:982-987

(Variation) Yanagisawa, S et al. 1988. FEBS Lett 229:107-110

(map data) Wright, S et al. 1987. MNL 61:89-90

(Variation) Grula, JW and Hudspeth, RL pp.207-216 in Key, JL and McIntosh, L. 1987.Alan R. Liss, Inc., New York

(cDNA sequence) Izui, K. 1986. Nucl Acid Res 4:1615-1628

(Genelist) Hudspeth, RL et al. 1986. Proc Natl Acad Sci, USA 83:2884-2888

(Genelist) Izui, K. 1986. Nucl Acid Res 4:1615-1628

(gene product) Harpster, MH and Taylor, WC. 1986. J Biol Chem 261:6132-6136

(restriction map) Izui, K. 1986. Nucl Acid Res 4:1615-1628

(transgenic expression) Izui, K. 1986. Nucl Acid Res 4:1615-1628

   

External Links


Additional External Resources:
X15238 (at EMBL via p-umc180)
X15238 (at GenBank via p-umc180)
X15238 (at DDBJ via p-umc180)
TC169403 (at TIGR/Dana Farber ZmGI via p-umc180)
S60262 (at EMBL via p-pepcZm1)
S60262 (at GenBank via p-pepcZm1)
S60262 (at DDBJ via p-pepcZm1)
TC169403 (at TIGR/Dana Farber ZmGI via p-pepcZm1)
X03613 (at EMBL via p-pM52)
X03613 (at GenBank via p-pM52)
X03613 (at DDBJ via p-pM52)
TC169403 (at TIGR/Dana Farber ZmGI via p-pM52)
X15239 (at EMBL via p-phi065)
X15239 (at GenBank via p-phi065)
X15239 (at DDBJ via p-phi065)
TC169403 (at TIGR/Dana Farber ZmGI via p-phi065)
X15642 (at GenBank via IDP2529)
AC190686 (at B73 Sequencing Project via c0168C06)
106 (at AGOL WebFPC 2005 via c0168C06)
AC190686 (at GenBank via c0168C06)
c0168C06 (at MGSCbac via c0168C06)
106 (at AGI WebFPC v2 via c0168C06)
ctg106 (at Maize B73 Genome Sequencing Project Contig v 1,2 via c0168C06)
ctg106 (at Maize B73 Genome Sequencing Project Contig 2005 via c0168C06)