Genomic Sequencing Utilizing a RescueMu Insert:
PCR Cocktail Preparation and Amplification

General Description: DH10B(tm) E. coli colonies containing RescueMu and the genomic DNA insert of interest are incubated for 19 hours, as described in the previous protocol. The incubated colonies are stamped into PCR plates for amplification of the insert DNA. This protocol outlines the procedures for preparing the PCR cocktail, stamping incubated colonies into PCR reaction plates, and running parameters for the reaction. After PCR, the amplified target DNA is ready to be cycle sequenced and purified.

Materials & Reagents

Material / Reagent	Vendor	Stock #
15 ml sterile tubes	Applied Scientific	AS-2004
Triton X-100 (10% solution)	Sigma-Aldrich	T-9284
MasterAmpä High Fidelity 2X ExtraLong PCR Premix 9	Epicentre Technologies	FS 99060-M3
Mu PCR Primer-L (located just internal to the RescueMu left terminal inverted repeat) CACCGCCGTGCTGCCGTAGAGCG (concentration @ 10 pmol/ml)	Operon Technologies	N/A
Mu PCR Primer-R (located just internal to the RescueMu right terminal inverted repeat) CGCGTGACTGAGATGCGACGGAG (concentration @ 10 pmol/ml)	Operon Technologies	N/A
MicroAmpÒ 384-well reaction plates	Perkin-Elmer/ABI	4305505
MasterAmpä Extra Long DNA Polymerase Mix (2.5 U/ml)	Epicentre	QU92500
Autoclaved deionized and distilled water (Autoclaved ddH2O)	Prepared at Genome Center	N/A
RescueMu colony plate	See Picking Protocol	N/A
384-well pin-tool	Incyte Genomics	ATD-6000
MicroAmpÒ Clear Adhesive Covers	Perkin-Elmer/ABI	4306311
Sterile reservoirs (25 ml)	Matrix	8096
Aluminum sealing tape	R.S. Hughes	425-3
GeneAmpÒ PCR System 9700	ABI	N8050001
Jouan CR412 Centrifuge	N/A	N/A
Ice	N/A	N/A

Procedure

1. Keep 15 ml tubes and cocktail components on ice prior to preparation.
2. Prepare cocktail by adding in this order:
   
3. After adding components of cocktail, mix gently.
4. Pour cocktail carefully into 25 ml sterile reservoir.
5. Dispense 10 microliter into each well of 384-well plate.
6. Spin in Jouan CR412 centrifuge at 2000 rpm for 20 seconds to remove any bubbles.
7. Place a 384-well pin-tool into 384-well colony plate and apply gentle, even pressure.
8. Gently rotate pin-tool for 15 seconds, remove carefully and place into 384 cocktail plate.
9. Agitate pin-tool by gently rocking back and forth in cocktail plate.
10. Let pin-tool sit undisturbed for 2 minutes to allow colony transfer.
11. Carefully remove pin-tool.
12. Put MicroAmp(R) tape over the 384-well PCR plate and spin in centrifuge up to 1000 rpm and stop immediately.
13. Seal 384-well colony plate with aluminum freezer tape and store at .80 C.

PCR Run

1. Use the following parameters for the PCR run using the GeneAmp(R) PCR System 9700:
   1. Initial Denaturation: 94 C for 1 minute.
   2. Denaturation: 94 C for 15 seconds.
   3. Annealing: 60 C for 30 seconds.
   4. Extension: 68 C for 23 minutes.
   5. Repeat steps 2-4 40 times (approximately 16.6 hours).
   6. Keep at 4 C until ready to perform sequencing reactions.

NOTE: Some RescuMu inserts are very large and fragments of the PCR product can exceed 15 kb in length. Given that the extension rate for the enzyme used is approximately 1 kb/min., a 23-minute extension is used to ensure as much PCR product can be recovered as possible. Shorter extension times (i.e. 10 . 15 minutes) may be used if the length of RescueMu inserts is known to be shorter. This can be achieved by employing different restriction enzymes during the plasmid rescue procedure.