|
|
 |
Genomic Sequencing Utilizing a RescueMu Insert:
Cycle Sequencing & Purifying Extension Products
General Description: The DNA inserts of interest are amplified using the Polymerase Chain Reaction (PCR) procedure outlined in the previous protocol. Dideoxy cycle sequencing is then performed utilizing PE Biosystems BigDye(tm) Ready Reaction Kit. The DNA cycle extension products are then purified using ethanol precipitation. This protocol outlines the procedures for cycle sequencing and purifying the extension products in preparation for reading of sequence on the MegaBace(tm) 1000 96-capillary machine.
Notes on sequencing primers: The primers Mu3-L and Mu3-R (see materials section below) are located at .122 from the outside end of the left (L) and right (R) terminal inverted repeats (TIRs), respectively. When using the MegaBace(tm) 1000 to sequence, the leading sequence is usually lost due to noise and excess dye-labeled ddNTP.s. The primers selected are a sufficient distance from the end of the TIR to allow detection of the TIR itself as well as the 9-base pair direct repeat in the host flanking sequence. These primers also exploit four polymorphic sites within the TIRs to decrease any chances of non-specific priming when performing the forward and reverse reactions. Primers closer to the outside edge of the TIR also work in the sequencing reactions. However, identification of the 9-base pair repeat is compromised in the cases where the initial section of sequence data is difficult to interpret.
Materials & Reagents:
|
Material / Reagent |
Vendor |
Stock # |
|
GeneAmpÒ PCR System 9700 |
ABI |
N8050001 |
|
Falconâ snap cap tubes, 5 ml |
Fisher Scientific |
14-959-11A |
|
Sterile reservoirs |
Matrix |
8096 |
|
MicroAmpâ 384-well reaction plates |
Perkin-Elmer/ABI |
4305505 |
|
BigDyeä Terminator v3.0 ready reaction cycle sequencing kit |
ABI |
4390244 |
|
10X MasterAmpä PCR Enhancer |
Epicentre Technologies |
ME81210 |
|
Mu3-L Primer (from left TIR ® out) AGCTGTCTCGTATCCGTTTTG (concentration @ 3.2 pmol/ml) |
Operon Technologies |
N/A |
|
Mu3-R Primer (from right TIR ® out) TGCTGTCTTGTGTCCGTTTTA (concentration @ 3.2 pmol/ml) |
Operon Technologies |
N/A |
|
Aluminum sealing tape |
R.S. Hughes |
425-3 |
|
Deionized and distilled water (ddH2O) |
Prepared at Genome Center |
N/A |
|
RescueMu PCR product |
See PCR protocol |
N/A |
|
Hydraä 96 microdispenser |
Robbins Scientificâ Corp. |
1029-40-3 |
|
MicroAmpÒ Clear Adhesive Covers |
Perkin-Elmer/ABI |
4306311 |
|
Beckman CS-6R Centrifuge |
N/A |
N/A |
|
Jouan CR412 Centrifuge |
N/A |
N/A |
|
96-well polypropylene CyclePlateâ |
Robbins Scientific Corp. |
1055-90-0 |
|
96-well plate base |
Marsh |
AB-0563 |
|
Ethanol |
N/A |
N/A |
|
Plate sealers |
Edge Biosystems, Inc. |
48461 |
|
Autoclaved ddH2O |
Prepared at Genome Center |
N/A |
Procedure
Preparing Cocktail
- Label two Falcon(tm) tubes, two reservoirs and two 384-well plates with .Left (y). and .Right (x).. (In reference to the Terminal Inverted Repeat (TIR) on either side of the insert in the Rescue Mu plasmid, .Left. and .Right. corresponds to the relative direction of extension into the insert from the TIR during cycle sequencing.)
- Add 1600 microl of BigDye(tm) to each Falcon(tm) tube.
- Add 800 microl of Mu3-L Primer and 800 microl of Mu3-R Primer to x and y Falcon(tm) tube.
- Add 400 microl of autoclaved ddH2O to each x and y Falcon(tm) tube.
- Add 400 microl of 10X MasterAmp(tm) PCR Enhancer to each Falcon(tm) tube.
- Replace caps on tubes and invert approximately 50 times.
384-well plate preparation
- Retrieve PCR plate and spin up to 2000 rpm for 10 seconds in a Jouan CR412 Centrifuge.
- Add appropriate tube of cocktail to each labeled reservoir.
- Dispense 8 microl of cocktail into each well of labeled 384-well plates.
- Spin both 384-well plates at 2000 rpm for 20 seconds.
Addition of PCR product to separate L & R 384 plates
- Using a Hydra(tm) 96 microdispenser, fill 20 microl of autoclaved ddH2O.
- Dispense autoclaved ddH2O into quadrant 1 of PCR plate.
- Using the Wash function with a wash volume of 20 microl, mix H2O/PCR mixture.
- Aspirate 2 microl of H2O/PCR mixture.
- Dispense 2 microl of H2O/PCR mixture into quadrant 1 of L-plate for a total volume of 10 microl.
- Perform a tip rinse with ddH2O using the wash function for a few seconds and repeat steps 4-6 for the R-plate.
- Perform a dirty and clean wash with ddH2O. (A dirty wash is performed by using the volume of ddH2O used for the last clean wash. A clean wash uses a fresh volume of ddH2O to wash the syringes).
- Repeat steps 1-7 for remaining quadrants in PCR plate.
- Cover both L and R plates with MicroAmp(tm) tape and spin at 2000 rpm for 20 seconds.
- Cover PCR plate with aluminum freezer tape and store in .20 C or .80 C freezer.
- Run cycle sequencing on a GeneAmp(tm) PCR System 9700 using the following parameters for a 10 microl reaction:
- Denaturation: 96 C for 10 seconds.
- Annealing: 50 C for 5 seconds.
- Extension: 60 C for 4 minutes.
- Repeat steps 1-3 35 times (approximately 2.5 hours).
- 4 C until ready to purify the extension products.
Purifying Extension Products
- Label four 96-well Robbins Scientific polypropylene cycle plates for each 384-well sequence plate (L and R) according to quadrant 1-4 and x or y direction (x = R; y = L).
- Using a Hydra? 96 microdispenser, fill 27 microl of ethanol.
- Aspirate 20 microl of cycle sequenced x (R) plate DNA from quadrant 1 for a total volume of 47 microl. Note: It is necessary to aspirate 10 microl above the actual volume in the cycle plate to ensure the entire sample is retrieved.
- Empty 47 microl of DNA/ethanol into the 96-well cycle plate corresponding to quadrant 1 of the x (R) plate and wash (wash volume = 30 microl) to mix well.
- Perform a dirty and clean wash with ddH2O between each dispense. (A dirty wash is performed by using the previous volume of ddH2O to wash the syringes. A clean wash uses a fresh volume of ddH2O.)
- Repeat steps 2-5 for the remaining quadrants.
- Repeat steps 2-5 for cycle sequenced y (L) plate DNA.
- Spin cycle plates in a Jouan CR412 Centrifuge for 40 minutes, 10 C at 4000 rpm.
- .Reverse spin. to 400 rpm in a Beckman CS-6R Centrifuge and immediately stop. (Immediately after 40 minute spin cycle, place plates gently upside down on paper towels and spin up to 400 rpm to remove ethanol/contaminants.)
- Dispense 100 microl of 70% cold ethanol into each well of 96-well cycle plates.
- Spin plates for in a Jouan CR412 Centrifuge for 15 minutes, 4 C at 4000 rpm.
- Immediately after spin, invert plates and gently shake out excess ethanol.
- Reverse spin to 400 rpm and immediately stop, using the method described previously.
- Air-dry plates under a low volume, small desktop fan for 10 minutes or until dry.
- Place clear adhesive tape over plates, crease over edges and attach sequencing bar-code label.
- Store plates up to a week at .20 C until ready for loading onto MegaBACE(tm) 1000 machines.
|