|
Project Documentation & Protocols: Maize Gene Discovery Project: ESTs: Libraries
Contents: Index | Libraries | Reports | Assembly | Annotation | Unigene | Search | Ordering | Protocols | FAQs
In these tables, the EST libraries for the Maize Gene Discovery
Project are described in numerical order. Other EST libraries
information can be obtained through ZmDB database.
|
Library |
486 - Immature leaf |
|
Made by |
Joseph Colasanti |
|
Cultivar |
B73 |
|
Organ |
Shoot |
|
Tissue |
Leaf |
|
Development stage |
P5/6 - P10/11 |
|
Host cell |
E. coli XL1-Blue MFR' |
|
Vector |
PBluescriptSK(-) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
TGTAAAACGACGG CCAGT (m13-21) |
|
3' Sequencing primer |
GGAAACAGCTA TGACCATG |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
The library was made from leaves P5/6 to P10/11. In terms of size, the leaves extend from 4 cm to 8 cm above the apex. This means that the bases of the leaves, nearest the apex, are not included. Also the outer leaves are not included.
|
|
Library |
487 - Apical meristem |
|
Made by |
Hake lab |
|
Cultivar |
B73 |
|
Organ |
Shoot |
|
Tissue |
Apical meristem |
|
Development stage |
Immature |
|
Host cell |
E.coli XL1-Blue |
|
Vector |
PBluescriptSK(-) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
|
|
Description |
This library was made from tissues enriched in shoot apical meristem, no young leaf primordia were included. |
|
Library |
496 - Stressed shoot |
|
Made by |
Hong Wang (Bohnert lab) |
|
Cultivar |
B73 |
|
Organ |
Shoot |
|
Tissue |
Seedling |
|
Development stage |
Salt stress |
|
Host cell |
E. coli XL Gold |
|
Vector |
PBluescriptII SK(+) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
The library is made from salt stressed shoot of B73 inbred. 8 seeds/pot were planted in a 4-inch pot. After germination, seedlings were kept at 23-28 °
C with 12 hours light. The seedlings were initially watered with tap water for the first two days, then with 0.25X Hoaglands solution, supplemented with 1 mM K+ and 2mM Ca++, for approximately 10 days until 3-4 leaves had appeared. The plants were subjected to salt stress by treatment with 150mM NaCl in 0.25X Hoaglands solution containing 1mM K+ and 2mM Ca++ for 24 hours. |
|
Library |
603 - Stressed root |
|
Made by |
Hong Wang (Bohnert lab) |
|
Cultivar |
B73 |
|
Organ |
Root |
|
Tissue |
Seedling |
|
Development stage |
Salt stress |
|
Host cell |
E. coli XL Gold |
|
Vector |
PbluescriptII SK(+) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
The library is made from salt stressed root of B73 inbred. 8 seeds/pot were planted in a 4-inch pot. After germination, seedlings were kept at 23-28 °
C with 12 hours exposure to light per day. The seedlings were initially watered with tap water for the first two days, then with 0.25X Hoaglands solution, supplemented with 1 mM K+ and 2mM Ca++, for approximately 10 days until 3-4 leaves had appeared. The plants were subjected to salt stress by treatment with 150mM NaCl in 0.25X Hoaglands solution containing 1mM K+ and 2mM Ca++ for 24 hours. |
|
Library |
605 - Endosperm |
|
Made by |
Schmidt lab |
|
Cultivar |
Ohio43 |
|
Organ |
Kernel |
|
Tissue |
Nucellus, embryo and endosperm |
|
Development stage |
10-14 days post pollination |
|
Host cell |
XLOLR |
|
Vector |
pAD-GAL4 |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid3.htm and
http://www.stratagene.com/vectors/selection/lambda.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
CTATTCGATGATGAAGATACC (custom) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
The library was constructed from poly (A+) RNA extracted from 10 to 14
days post pollinated endosperm, which also included 10-11 DAP embryo and
nucellar tissue. The cDNAs were directionally cloned into the
EcoRI/XhoI sites of Stratagene's HybriZAP and were excised
as inserts in phagemid pAD-GAL4. |
|
Library |
606 - Ear tissue |
|
Made by |
Schmidt lab |
|
Cultivar |
Ohio43 |
|
Organ |
Immature ear |
|
Tissue |
Mixed |
|
Development stage |
Ear length from 0.5cm-2.0cm |
|
Host cell |
XLOLR |
|
Vector |
pBK-CMV |
|
Vector type |
Phagemid |
|
Selection marker |
Neo-Kan |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/dualmode.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
The library was constructed from poly (A+) RNA using a cDNA synthesis kit from Stratagene. The cDNAs were directionally cloned into the EcoRI/XhoI sites of Stratagene's lambda ZAP Express and excised as inserts in plasmid pBK-CMV. |
|
Library |
614 - Root |
|
Made by |
Lukas Mueller (Walbot lab) |
|
Cultivar |
W23 |
|
Organ |
Root |
|
Tissue |
Root |
|
Development stage |
3-4 days old |
|
Host cell |
XLOLR |
|
Vector |
PBluescriptII SK(+) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page
http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
The library was made from inbred W23 maize roots grown in the dark for 3 to 4 days. The roots were 0.5 to 2.0 cm long. The cDNAs were directionally cloned into pBluescript SK(+). |
|
Library |
618 - Tassel primordia |
|
Made by |
Schmidt lab |
|
Cultivar |
Ohio43 |
|
Organ |
Tassel |
|
Tissue |
Tassel |
|
Development stage |
Tassel length from 0.1 to 2.5 cm |
|
Host cell |
XLOLR |
|
Vector |
pAD-GAL4 |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid3.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
CTATTCGATGATGAAGATACC (custom) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
|
|
Library |
660 - Mixed stages of anther and pollen |
|
Made by |
Walden laboratory; plasmids prepped by Amie Franklin |
|
Cultivar |
Ohio43 |
|
Organ |
Anther, pollen |
|
Tissue |
Whole premieotic anthers to pollen shed |
|
Development stage |
Premieotic anthers to pollen shed |
|
Host cell |
XLOLR |
|
Vector |
PBluescriptSK(-) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm
http://www.stratagene.com/vectors/selection/lambda.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
The library was constructed using Lambda ZAP commercially available from Stratagene. |
|
Library |
683 - 14 day immature embryo |
|
Made by |
Hake lab |
|
Cultivar |
B73 |
|
Organ |
Embryo |
|
Tissue |
Embryo |
|
Development stage |
14 days after pollination |
|
Host cell |
DH10B |
|
Vector |
pBK-CMV |
|
Vector type |
Phagemid |
|
Selection marker |
Neo-Kan |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/dualmode.htm http://www.stratagene.com/vectors/selection/lambda.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
Library was constructed by directional cloning of the inserts in vector pBK-CMV using the ZAP Express cDNA synthesis kit from Stratagene. |
|
Library |
687 - mixed stages of embryo development |
|
Made by |
Torbert Rocheford lab |
|
Cultivar |
Illinois High Oil |
|
Organ |
Ear |
|
Tissue |
Embryo |
|
Development stage |
14, 21, 28, and 35 days after pollination |
|
Host cell |
E.coli SOLR |
|
Vector |
PBluescript SK(-) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
687 was developed from a pool of equal amounts of RNA from developing embryos sampled at 14, 21, 28 and 35 days after pollination of the Illinois High Oil Maize Strain Cycle 90. This closed strain has been selected for high oil concentration for 90 generations and originates from the 1890s era open pollinated variety Burr's White. The library was prepared by Stratagene using the Uni-ZAP XR system (Stratagene BN937328-12). Clones were picked by a Q-bot after blue/white selection.
|
|
Library |
707 - Mixed adult tissues |
|
Made by |
Soo-Hwan Kim (Walbot lab) |
|
Cultivar |
W23 |
|
Organ |
Tassel, kernel, silk, husk, root, leaf |
|
Tissue |
Tassel, kernel, silk, husk, root, leaf |
|
Development stage |
Adult |
|
Host cell |
DH10B |
|
Vector |
PGAD10 |
|
Vector type |
Plasmid |
|
Selection marker |
Ampr |
|
Vector information |
See Clontech web page
http://www.clontech.com/techinfo/vectors/pGAD10.html |
|
5' Sequencing primer |
GTGAACTTGCGGGGTTTTTCA (forward custom) |
|
3' Sequencing primer |
CTATTCGATGATGAAGATACC (reverse custom) |
|
Cloning sites |
EcoRI |
|
Description |
The cDNA library was prepared from fully differentiated maize tissues harvested from an active Mutator plant. The tissue ratio by weight was 4:2:1:1:1:1 (tassel:kernel:silk:husk:root:leaf). CDNAs were directionally cloned. |
|
Library |
829 - Silk infected with Fusarium |
|
Made by |
Sharon Allard |
|
Cultivar |
B73 |
|
Organ |
Silk |
|
Tissue |
Silk |
|
Development stage |
Adult |
|
Host cell |
DH10B |
|
Vector |
pBluescript II SK(+) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
cDNA library of silk infected with 1 microliter of 500,000 spores/ml solution of Fusarium graminearum DACM 180378. The library was prepared by Sharon Allard of Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada using Stratagene cDNA synthesis kit. Silk was harvested at 72 hours post-infection.
|
|
Library |
945 - Mixed adult tissues
Note: 945 and 707 are exactly the same thing - just
two different times of sequencing |
|
Made by |
Soo-Hwan Kim (Walbot lab) |
|
Cultivar |
W23 |
|
Organ |
Tassel, kernel, silk, husk, root, leaf |
|
Tissue |
Tassel, kernel, silk, husk, root, leaf |
|
Development stage |
Adult |
|
Host cell |
DH10B |
|
Vector |
PGAD10 |
|
Vector type |
Plasmid |
|
Selection marker |
Ampr |
|
Vector information |
See Clontech web page
http://www.clontech.com/techinfo/vectors/pGAD10.html |
|
5' Sequencing primer |
(not yet determined) |
|
3' Sequencing primer |
TACCACTACAATGGATG (reverse custom) |
|
Cloning sites |
EcoRI |
|
Description |
The cDNA library was prepared from fully differentiated maize tissues harvested from an active Mutator plant. The tissue ratio by weight was 4:2:1:1:1:1 (tassel:kernel:silk:husk:root:leaf). CDNAs were directionally cloned.New library number given to library 707 for additional sequencing. |
|
Library |
946 - tassel primordium prepared by Schmidt lab |
|
Made by |
George Chuck, Sharon Stanfield |
|
Cultivar |
OH43 |
|
Organ |
Tassels |
|
Tissue |
Tassels |
|
Development stage |
just after the transition from vegetative to inflorescence |
|
Host cell |
XLOLR |
|
Vector |
PAD-GAL4-2.1 |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See CloneTech's web page http://www.clontech.com/techinfo/vectors_dis/pGAD10.html |
|
5' Sequencing primer |
CTATTCGATGATGAAGATACC (custom) |
|
3' Sequencing primer |
TAATACGACTCACTATAGGGC (T7 promotor sequence) |
|
Cloning sites |
XhoI/EcoRI |
|
Description |
George Chuck dissected immature tassels between 1mm and 3mm. Sharon Stanfield prepared the cDNA library in HybriZAP. Sample insert size range was 350 bp to 3 Kb with a 1 Kb average.
|
|
Library |
947 - 2 week shoot from Barkan lab |
|
Made by |
Alice Barkan |
|
Cultivar |
B73 |
|
Organ |
Shoot |
|
Tissue |
leaf and stem, including leaf base |
|
Development stage |
2 week old seedling (3 leaves) |
|
Host cell |
XL1-Blue |
|
Vector |
pBlueScript SK- |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm |
|
5' Sequencing primer |
AATACGACTCACTATAG (T7) |
|
3' Sequencing primer |
ATTAACCCTCACTAAAG (T3) |
|
|
Cloning sites |
XhoI/EcoRI |
|
Description |
Directionally cloned using Stratagene's UniZap XR cDNA cloning kit with
the 5' end at the EcoRI site. The library represents 8X10e5 independent recombinant phage. The library was greenhouse grown.
|
|
Library |
949 - Juvenile leaf and shoot cDNA from Steve Moose |
|
Made by |
Steve Moose, Schmidt's lab |
|
Cultivar |
W64A |
|
Organ |
Juvenile vegetative shoots |
|
Tissue |
Immature leaf primordium and vegetative meristem |
|
Development stage |
4 stages from 3-13 days after imbibing |
|
Host cell |
E. coli XLOLR |
|
Vector |
pAD-GAL4-2.1 |
|
Vector type |
Plasmid |
|
Selection marker |
Ampr |
|
5' Sequencing primer |
CTATTCGATGATGAAGATACC (custom) |
|
3' Sequencing primer |
TAATACGACTCACTATAGGGC (T7 promotor sequence) |
|
Cloning sites |
EcoRI/XhoI |
|
Description |
Equal amounts of total RNA by weight from 4 tissue sources (see below)
were pooled, polyA+ RNA isolated, and cDNA synthesized for EcoRI (5')
and XhoI (3') directional cloning into lambda Hybrizap vector from
Stratagene.
Tissue Sources.
1. Whole shoots 3 days after sowing/imbibing in wet soil.
2. Basal 1.5 cm shoots 6 days after sowing - includes yellow portions
of developing leaves 1-5, primordia from 6-8, and the vegetative apex.
3. Non-green portions of developing leaves 4-5 and the vegetative apex,
including adult leaf primordia, 9 days after sowing.
4. Partially expanded and greening leaves 4-5 at 13 days after sowing.
|
|
Library |
950 and 3524 - Mature pollen from Sheila McCormick's lab. Note: This library was sequenced at two different
times, hence the two project tracking numbers |
|
Made by |
Rima Kulikauskas |
|
Cultivar |
B73 |
|
Organ |
N/A |
|
Tissue |
Pollen |
|
Development stage |
Mature |
|
Host cell |
SOLR |
|
Vector |
Stratagene's Uni-Zap XR (pBluescript SK-) |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Cloning sites |
EcoRI/XhoI |
|
Description |
Unamplified cDNA library directionally cloned by Rima Kulikauskas using Stratagene's Uni-Zap system. Insert sizes ranged from 0.5Kb to 2Kb. 50 microliter aliquot had 338,000 pfu when it was made in Sept, 1995, from oligo dT-primed poly A+ RNA.
|
|
Library |
951 - BMS tissue from Walbot Lab (GR) |
|
Made by |
George Rudenko |
|
Cultivar |
BMS (Black Mexican Sweet) |
|
Organ |
N/A |
|
Tissue |
Suspension culture |
|
Development stage |
Mixed logarithmic and stationary growth phases |
|
Host cell |
DH10B |
|
Vector |
pUC19 |
|
Vector type |
Plasmid |
|
Selection marker |
Ampr |
|
Cloning sites |
EcoRI/EcoRI |
|
Description |
The library was prepared by George Rudenko using poly (A) selected RNA and
Universal Riboclone cDNA Synthesis System (Promega). cDNA was synthesized
using both random and oligo(dT) primers in separate reactions and equipped
with EcoRI adaptors. Library was size-fractionated on agarose gels (for
insert size >400bp) and non-directionally cloned into EcoRI-digested pUC19
vector. Blue/white selection on carbenicillin-containing plates was used
to recover positive clones.
Everything about 951 and 952 is the same except they were prepared at
different times. The reason is that 951 had a lot of ribosomal RNA so the
library was redone with an additional screening/selection step for mRNA.
|
|
Library |
952 - BMS tissue from Walbot Lab (GR) |
|
Made by |
George Rudenko |
|
Cultivar |
BMS (Black Mexican Sweet) |
|
Organ |
N/A |
|
Tissue |
Suspension culture |
|
Development stage |
Mixed logarithmic and stationary growth phases |
|
Host cell |
DH10B |
|
Vector |
pUC19 |
|
Vector type |
Plasmid |
|
Selection marker |
Ampr |
|
Cloning sites |
EcoRI/EcoRI |
|
Description |
The library was prepared by George Rudenko using poly (A) selected RNA and
Universal Riboclone cDNA Synthesis System (Promega). cDNA was synthesized
using both random and oligo(dT) primers in separate reactions and equipped
with EcoRI adaptors. Library was size-fractionated on agarose gels (for
insert size >400bp) and non-directionally cloned into EcoRI-digested pUC19
vector. Blue/white selection on carbenicillin-containing plates was used
to recover positive clones.
|
|
Library |
953 - Immature ear with common ESTs screened by Schmidt lab |
|
Made by |
Schmidt lab |
|
Cultivar |
OH43 |
|
Organ |
Immature ear |
|
Tissue |
Inflorescence meristem - floral organ primordia |
|
Development stage |
0.5 cm to 2 cm |
|
Host cell |
Stratagene XLOLR |
|
Vector |
ZAP Express (pBK-CMV) |
|
Vector type |
Phagemid |
|
Selection marker |
Neo-Kan |
|
Cloning sites |
EcoRI\/XhoI |
|
Description |
RNA from library 606 was filtered for common ESTs found in 606.
|
|
Library |
1091 - Immature ear tissue with common inserts from library 606
screened by Schmidt lab
Note: 1091 is library 606 subtracted for common clones to
enrich for rare clones |
|
Made by |
Sharon Stanfield |
|
Cultivar |
B73 |
|
Organ |
Immature ear |
|
Tissue |
Mixed |
|
Development stage |
Before pollen shed |
|
Host cell |
Stratagene XLOLR |
|
Vector |
pAD-GAL4 |
|
Vector type |
Phagemid |
|
Selection marker |
Ampr |
|
Vector information |
See Stratagene's web page http://www.stratagene.com/vectors/selection/pasmid1.htm
|
|
5' Sequencing primer |
CTATTCGATGATGAAGATACC (custom)
|
|
3' Sequencing primer |
TAATACGACTCACTATAGGGC (T7 promotor sequence)
|
|
Cloning sites
|
EcoRI/XhoI |
|
Description
|
Ear cDNA library derived from developing ears (0.5 to 2.0 cm) of inbred
OH43. Directionally cloned into the EcoRI/XhoI sites in ZapExpress.
Sequenced from plasmids (pBK-CMV). Created by Schmidt lab.
|
|
Library |
3524 - Mature pollen from Sheila McCormick's lab |
|
Made by |
Rima Kulikauskas |
|
Cultivar |
B73 |
|
Tissue |
Pollen |
|
Development stage |
Mature |
|
Host cell |
SOLR |
|
Vector |
Stratagene's Uni-Zap XR (pBluescript SK-) |
|
Selection marker |
Ampr |
|
Cloning sites
|
EcoRI/XhoI |
|
Description
|
Unamplified cDNA library directionally cloned by Rima Kulikauskas
using Stratagene's Uni-Zap system. Insert sizes ranged from 0.5Kb to
2Kb. 50 Microliter aliquot had 338,000 pfu when it was made in Sept,
1995, from oligo dT-primed poly A+ RNA. |
|
Library |
3528 - Positive selection of MADS-box genes from ear library 946 |
|
Cultivar |
OH43 |
|
Tissue |
ear |
|
Development stage |
0.5 cm - 2.0 cm |
|
Host cell |
XLOLR |
|
Vector |
pAD-GAL4 |
|
Selection marker |
Ampr |
|
Cloning sites
|
EcoRI/XhoI |
|
Description
|
Schmidt lab dissected immature ears between 0.5 cm - 2.0 cm. Sharon
Stanfield prepared the cDNA library in HybriZAP. Positive selection by
probing with the pooled full-length cDNA of the following MADS box genes:
ZAGL8B, ZAGL9B, ZAGL17, SI, ZAG1, ZAG2, ZAP1A, ZMM2, and ZPIA. Negative
selection by probing with pooled 3'-end fragments of the same DNA. The
final library is derived from a total of 210 selected plaques that
hybridized with the full-length cDNA probes, but not with the 3'-end cDNA
probes.
|
Return to Documentation Index | Return to Maize Gene Discovery Project Index | Return to Homepage
|